View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_low_41 (Length: 227)
Name: NF3211_low_41
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_low_41 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 8063263 - 8063185
Alignment:
| Q |
149 |
cagggtatttgccgtaactgatataccgaaaaacttgtgtatttttccacatcgtggatcaacccaaaataattcacaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8063263 |
cagggtatttgccgtaactgatataccgaaaaacttgtgtatttttccacatcgtggatcaacccaaaataattcacaa |
8063185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 8063398 - 8063336
Alignment:
| Q |
7 |
tgtttttggtcaaatcttcaatcatattaagatagtgttctctcttctgttgacacaaaaccc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8063398 |
tgtttttggtcaaatcttcaatcatattaagatagtgttctctcttctgttgacacaaaaccc |
8063336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University