View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212-Insertion-8 (Length: 92)
Name: NF3212-Insertion-8
Description: NF3212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 3e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 7 - 88
Target Start/End: Original strand, 29518952 - 29519033
Alignment:
| Q |
7 |
agttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattatgtcaactcgagcagactcgttgtcttg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29518952 |
agttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattatgtcaactcgagcagactcgttgtcttg |
29519033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University