View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212R-Insertion-11 (Length: 275)
Name: NF3212R-Insertion-11
Description: NF3212R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212R-Insertion-11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 53173584 - 53173699
Alignment:
| Q |
9 |
gtgactgcatgaaatattcgactgcagcttaataattttctcaagtgatactacacatgttcgtcaactggtttgattttagttatattgaattggtcac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53173584 |
gtgactgcatgaaatattcgactgcagcttaataattttttcaagtgatactacacatgttcgtcaactggtttgattttagttatattgaattggtcac |
53173683 |
T |
|
| Q |
109 |
acagaagttctacaag |
124 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53173684 |
acagaagttctacaag |
53173699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 198 - 275
Target Start/End: Original strand, 53173773 - 53173850
Alignment:
| Q |
198 |
agttatattacagtttgatcaaattaaattgaactggttaatcatggttcaacaagttttggtcttttacattattca |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53173773 |
agttgtattacagtttgatcaaattaaattgaattggttaatcatggttcaacaagttttggtcttttacattattca |
53173850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University