View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212R-Insertion-14 (Length: 191)
Name: NF3212R-Insertion-14
Description: NF3212R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212R-Insertion-14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 9 - 191
Target Start/End: Complemental strand, 43015185 - 43015003
Alignment:
| Q |
9 |
ttcgattctttccaaagttggtgtagagaacaagaattttcttgcaacctttttgtttaccattaaccataacaggtctggtcttaccagttttgtgcca |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015185 |
ttcgattctttccgaagttggtgtagagaacaagaattttcttgcaacctttttgtttaccattaaccataacaggtctggtcttaccagttttgtgcca |
43015086 |
T |
 |
| Q |
109 |
tcttgtttctcctcctgtacttccttgtaagtcacactcttcggtttgaatctttctcctctttcgtgttcctgttgtatatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015085 |
tcttgtttctcctcctgtacttccttgtaagtcacactcttcggtttgaatctttctcctctttcgtgttcctgttgtatatg |
43015003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University