View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3212R-Insertion-18 (Length: 98)

Name: NF3212R-Insertion-18
Description: NF3212R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3212R-Insertion-18
NF3212R-Insertion-18
[»] chr1 (1 HSPs)
chr1 (9-84)||(41826710-41826785)
[»] chr5 (1 HSPs)
chr5 (23-62)||(4076065-4076104)
[»] chr2 (2 HSPs)
chr2 (22-59)||(33657402-33657439)
chr2 (27-62)||(43603273-43603308)
[»] chr7 (1 HSPs)
chr7 (27-62)||(39538420-39538455)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 6e-31
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 41826785 - 41826710
Alignment:
Q  9 aaaaagttgaacgttttcaatgatctaacggttatgattgattgatagtgtaaactctcattattacgtatgattc 84  Q
    ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  41826785 aaaaagttgaatgttttcaatgatctaacgattatgattgattgatagtgtaaactctcattattacgtatgattc 41826710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000008
Query Start/End: Original strand, 23 - 62
Target Start/End: Original strand, 4076065 - 4076104
Alignment:
Q  23 tttcaatgatctaacggttatgattgattgatagtgtaaa 62  Q
    |||||||||||||||| |||||||||||||||||||||||    
T  4076065 tttcaatgatctaacgattatgattgattgatagtgtaaa 4076104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 33657439 - 33657402
Alignment:
Q  22 ttttcaatgatctaacggttatgattgattgatagtgt 59  Q
    ||||||||||| | ||||||||||||||||||||||||    
T  33657439 ttttcaatgatttgacggttatgattgattgatagtgt 33657402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 62
Target Start/End: Original strand, 43603273 - 43603308
Alignment:
Q  27 aatgatctaacggttatgattgattgatagtgtaaa 62  Q
    |||||||||||| |||||||||||| ||||||||||    
T  43603273 aatgatctaacgcttatgattgattaatagtgtaaa 43603308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 39538455 - 39538420
Alignment:
Q  27 aatgatctaacggttatgattgattgatagtgtaaa 62  Q
    ||||||||||||||||| ||||||||||||| ||||    
T  39538455 aatgatctaacggttataattgattgatagtataaa 39538420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University