View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_1D_high_23 (Length: 208)
Name: NF3212_1D_high_23
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_1D_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 1500217 - 1500310
Alignment:
| Q |
17 |
gtatgcatgtatgtatatttgatatggtaaatagctttataccataactagtgtggtctcttcnnnnnnnccataaaaataatggaagttacaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1500217 |
gtatgcatgtatgtatatttgatatggtaaatagctttataccatacctagtgtggtctcttctttttttccataaaaataatggaagttacaa |
1500310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University