View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_1D_low_12 (Length: 274)
Name: NF3212_1D_low_12
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_1D_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 95 - 194
Target Start/End: Original strand, 361573 - 361672
Alignment:
| Q |
95 |
attattactagtgtccatatgttagtgtaccctaccgacacacgtgattacatccttaactcatgttctcgatttgttaccagtggtgatgtgttttcat |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361573 |
attattacaagtgtccatatgttagtgtaccataccgatacacgtgattacatccttaactcatgttctcgatttgttaccagtggtgatgtgttttcat |
361672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University