View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3212_1D_low_18 (Length: 244)

Name: NF3212_1D_low_18
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3212_1D_low_18
NF3212_1D_low_18
[»] chr1 (1 HSPs)
chr1 (12-68)||(40856934-40856990)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 40856934 - 40856990
Alignment:
12 atgaacaagaattcaagtgttgtaacacattgcccttttggtttaatctcttggtgg 68  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
40856934 atgaacaagatttcaagtgttgtaacacattgcccttttggtttaatctcttggtgg 40856990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University