View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3212_1D_low_24 (Length: 231)

Name: NF3212_1D_low_24
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3212_1D_low_24
NF3212_1D_low_24
[»] chr2 (1 HSPs)
chr2 (96-198)||(40401886-40401988)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 198
Target Start/End: Original strand, 40401886 - 40401988
Alignment:
96 gaagaaagattaagcaaattacttttctattaatactctctcttccattatccattacacgaatgcatgaatccacaatagcacttctcacaggatcctg 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40401886 gaagaaagattaagcaaattacttttctattaatactctctcttccattatccattacacgaatgcatgaatccacaatagcacttctcacaggatcctg 40401985  T
196 aag 198  Q
    |||    
40401986 aag 40401988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University