View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_1D_low_29 (Length: 210)
Name: NF3212_1D_low_29
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_1D_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 146 - 204
Target Start/End: Original strand, 35476681 - 35476739
Alignment:
| Q |
146 |
gtatattgttggtgcatattttttggtcaaactaatacatcacatttgttttatagtat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35476681 |
gtatattgttggtgcatattttttggtcaaactaatacatcacatttgttttgtagtat |
35476739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University