View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3212_1D_low_29 (Length: 210)

Name: NF3212_1D_low_29
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3212_1D_low_29
NF3212_1D_low_29
[»] chr5 (1 HSPs)
chr5 (146-204)||(35476681-35476739)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 146 - 204
Target Start/End: Original strand, 35476681 - 35476739
Alignment:
146 gtatattgttggtgcatattttttggtcaaactaatacatcacatttgttttatagtat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
35476681 gtatattgttggtgcatattttttggtcaaactaatacatcacatttgttttgtagtat 35476739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University