View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_1D_low_7 (Length: 312)
Name: NF3212_1D_low_7
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_1D_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 48398327 - 48398018
Alignment:
| Q |
1 |
gtttactagagagggtcccaccacttccaaaagaaacaaacagaacactcccgtgtgcttgattatctaaccatttcaaactctctgagttcggtccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398327 |
gtttactagagagggtcccaccacttccaaaagaaacaaacagaacactcccatgtggttgattatctaaccatttcaaactctctgagttcggtccaat |
48398228 |
T |
 |
| Q |
101 |
ttgacctacttctacttctctctgtactaatggtccaaccgggtaaaacttaggttttccaggttcttcctttagtaactccttgattggacccggttca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398227 |
ttgacctacttctacttctctctttactaatggtccaaccgggtaaaacttaggttttcctggttcttcctttagtaactccttgattggacccggttca |
48398128 |
T |
 |
| Q |
201 |
agttcaagaaaactgttctctagatgtccatctcattggctctgtatctcttcgcgttgcgaaagacactttggtaagcatcgttcttcctgtcttgaag |
300 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398127 |
agttcaagaaaactattctctataagtccatctgctt--ctctgtatctcttcgcgttgcgaaagacactttggtaagcatcgttcttcctgtcttgaag |
48398030 |
T |
 |
| Q |
301 |
cgggtctagtaa |
312 |
Q |
| |
|
||||||||||| |
|
|
| T |
48398029 |
agggtctagtaa |
48398018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University