View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_1D_low_9 (Length: 292)
Name: NF3212_1D_low_9
Description: NF3212_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_1D_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 88 - 291
Target Start/End: Original strand, 12552026 - 12552231
Alignment:
| Q |
88 |
atcaagagagggaaattcacagatgaagaagaaagagttatcatcaaccttcattcagttcttggaaacaagtatatttcttaacttgttttttcttatg |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12552026 |
atcaagagagggaaattcactgatgaagaagaaagagttatcatcaaccttcattcagttcttggaaacaagtatatttcttatcttgttttttcttatg |
12552125 |
T |
|
| Q |
188 |
tagaaaatgatattgaaatcactctaaagatagcgacggaatttcacagacggaaaaaataatttcgtctctaattccatcactaagtgtt--agacgtc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12552126 |
tagaaaatgatattgaaatcactctaaagatagcgacggaatttcagagacggaaaaaataatttcgtctctaattccatcactaagtgttagagacgtc |
12552225 |
T |
|
| Q |
286 |
aatttt |
291 |
Q |
| |
|
|||||| |
|
|
| T |
12552226 |
aatttt |
12552231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University