View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_2D_low_2 (Length: 515)
Name: NF3212_2D_low_2
Description: NF3212_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_2D_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 452; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 452; E-Value: 0
Query Start/End: Original strand, 22 - 501
Target Start/End: Complemental strand, 19913491 - 19913012
Alignment:
| Q |
22 |
agatggttgtgtaaacaatccttgaaaaccaaccccaattttcccttttcctaaaacatcaccaagaacaacttgctttgttgttgcattagcccaatta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913491 |
agatggttgtgtaaacaatccttgaaaaccaaccccaattttcccttttcctaaaacatcaccaagaacaacttgctttgttgttgcattagcccaatta |
19913392 |
T |
 |
| Q |
122 |
aaaggtggtggtgcagcaccaaccgctgacctagtcaaccccattgttacacctgaaccctcaatttcctccgaaccaccaccaccggtagctcctgcgg |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913391 |
aaaggtggtggtgcagcaccaaccgttgacctattcaaccccattgttacacctgaaccttcaatttcctccgaaccaccaccaccggtagctcctgcgg |
19913292 |
T |
 |
| Q |
222 |
cggtggaggtggaatctttctccgacttggaaactctctgcttctccgacctccgtctcttagcctccatccgccgcaacgtctgtaactccttcctctt |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913291 |
cggtggaggtggaatctttgtccgacttggaaactctctgcttctccgacctccgtctcttagcctccatccgccgcaacgtctgtaactccttcctctt |
19913192 |
T |
 |
| Q |
322 |
ccgccactcttcctccgtctccgttggcaacgacgatgatctgataagtgtcggatacgccggagtgggcgaagccactccggcggccgcggcaatatct |
421 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19913191 |
ccgccactcttcctccgtctctgttggcaacgacgatgatctgataagtgtcggatacgccggagtgggtgaagccactccggcggccgcggcaatatct |
19913092 |
T |
 |
| Q |
422 |
tcccggagtaaaggcattgttccaaccactgaagaagatcgtgtaagcttcttattgtttgcatgtttgtcaacaccaaa |
501 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913091 |
tcccggagcaaaggcattgttccaaccactgaagaagatcgtgtaagcttcttattgtttgcatgtttgtcaacaccaaa |
19913012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University