View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3212_2D_low_6 (Length: 267)
Name: NF3212_2D_low_6
Description: NF3212_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3212_2D_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 35258913 - 35258677
Alignment:
| Q |
20 |
gacagaagaggaagaaaagttgtggaattttatgttggaggaagcttcaaagatgcaaagagaattgaggggtgaggatttggatcatgaaacaatgatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35258913 |
gacagaagaggaagaaaagttgtggaattttatgttggaggaagcttcaaagatacaaagagaattgaggggtgaggatttggatcatgaaacaatgatg |
35258814 |
T |
 |
| Q |
120 |
aagtttctgagtcctgtttctgtggagattgaaggggatcaatatgaggaatatgagaaaactgatgcttattacaaaaagcatataaatcttgcacctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35258813 |
aagtttctgagtcctgtttctgtggagattgaaggggatcaatatgaggaatatgagaaaactgatgcttattacaaaaagcatataaatcttgcacctt |
35258714 |
T |
 |
| Q |
220 |
acaattcacttcttctgtctaactatgcacaggttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35258713 |
acaattcacttcttctgtctaactatgcacagtttct |
35258677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University