View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3213_high_4 (Length: 308)
Name: NF3213_high_4
Description: NF3213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3213_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 36386821 - 36386709
Alignment:
| Q |
19 |
gtggttagtctcacaaaagatatgagagattttgaaccctaaaagtattgctttaaacccattagttttggtcacaaaaccatagcaatggtgtctcgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36386821 |
gtggttagtctcacaaaagatatgagagattttgaaccctaaaagtattgctttaaacccattagttttggtcacaaaaccatagcaatggtgtctcgta |
36386722 |
T |
|
| Q |
119 |
ttactcccttaat |
131 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
36386721 |
ttacccccttaat |
36386709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 201 - 296
Target Start/End: Complemental strand, 36386638 - 36386543
Alignment:
| Q |
201 |
caacttcagtgcaagacgaatttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctgctcttc |
296 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36386638 |
caacttcagtgcgagacgaatttctcttaactcagaccttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctgctcttc |
36386543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 203 - 294
Target Start/End: Complemental strand, 35869714 - 35869626
Alignment:
| Q |
203 |
acttcagtgcaagacgaatttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctgctct |
294 |
Q |
| |
|
|||||| ||| |||||||||||||||| || ||| |||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
35869714 |
acttcaatgcgagacgaatttctcttagctgagaccttgtttcgaagatatgaaca---aaaaggtagacacaaatgttgtgaacctgctct |
35869626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 219 - 272
Target Start/End: Complemental strand, 32008993 - 32008940
Alignment:
| Q |
219 |
aatttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagac |
272 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
32008993 |
aatttctcttaactcaaaccttgtttcgacgatccaaacggtgaaaaggtagac |
32008940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 220 - 292
Target Start/End: Original strand, 10698258 - 10698330
Alignment:
| Q |
220 |
atttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctgct |
292 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
10698258 |
atttctctcaactcagaccttgtttcgacaatccaaacggtgaaaaggtagacccaggtgttgtgaacctgct |
10698330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 220 - 292
Target Start/End: Original strand, 10912025 - 10912097
Alignment:
| Q |
220 |
atttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctgct |
292 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
10912025 |
atttctctcaactcagaccttgtttcgacaatccaaacggtgaaaaggtagacccaggtgttgtgaacctgct |
10912097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 290
Target Start/End: Complemental strand, 10673900 - 10673830
Alignment:
| Q |
220 |
atttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctg |
290 |
Q |
| |
|
|||| ||| |||||||| |||||||||| |||||| || || ||||||||||| | |||||||||||||| |
|
|
| T |
10673900 |
atttttctcaactcagaccttgtttcgacgatccagacggtcaaaaggtagacccagatgttgtgaacctg |
10673830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 290
Target Start/End: Complemental strand, 10887540 - 10887470
Alignment:
| Q |
220 |
atttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagacaccaatgttgtgaacctg |
290 |
Q |
| |
|
|||| ||| |||||||| |||||||||| |||||| || || ||||||||||| | |||||||||||||| |
|
|
| T |
10887540 |
atttttctcaactcagaccttgtttcgacgatccagacggtcaaaaggtagacccagatgttgtgaacctg |
10887470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 217 - 272
Target Start/End: Complemental strand, 14435039 - 14434984
Alignment:
| Q |
217 |
cgaatttctcttaactcagatcttgtttcgaagatccaaacagtgaaaaggtagac |
272 |
Q |
| |
|
||||||||||| | ||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14435039 |
cgaatttctctcagctcaggccttgtttcgacgatccaaacggtgaaaaggtagac |
14434984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University