View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3215-Insertion-7 (Length: 335)
Name: NF3215-Insertion-7
Description: NF3215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3215-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 8 - 335
Target Start/End: Original strand, 53006739 - 53007065
Alignment:
| Q |
8 |
atgagtgtgttagaatttcggtgaactagtgcaattttagtaaaagctaatcaagctttnnnnnnntcacagcgtcagtgtgattttgcaaaatccattg |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53006739 |
atgagtgtgttagaattttggtgaactaatgcaattttagtaaaagctaatcaagctttaaaaaa-tcacagcgtcagtgtgattttgcaaaatccattg |
53006837 |
T |
 |
| Q |
108 |
ctcatccaaacttgaaaatgagatcttaaatagagatatatagtaacgtatcaatcatgacccttacaattttacattgtaggtctagtgaccgattctc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
53006838 |
ctcatccaaacttgaaaatgagatcttaaatagagatatatagtaacgtgtcaatcatgactcttacaattttacattataggtttagtgaccgattctc |
53006937 |
T |
 |
| Q |
208 |
gacatcacgggttccctaaaactttttacgagaaaatttacctacaacatctaaccattatcatattatgttatcggtgattggctcgttgatcttaaag |
307 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
53006938 |
gacatcatgggttccctaaaactttttacgagaaaatttacctacaacatctaaccattatcatattatattgtcggtgattgactcgttgatcttaaag |
53007037 |
T |
 |
| Q |
308 |
tagagaatgactgacttgttgatcctga |
335 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |
|
|
| T |
53007038 |
tagagaataactgactcgttgatcctga |
53007065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University