View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3215-Insertion-8 (Length: 222)
Name: NF3215-Insertion-8
Description: NF3215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3215-Insertion-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 63
Target Start/End: Complemental strand, 31806432 - 31806397
Alignment:
| Q |
28 |
attatcagtcatctataggtaataggttggaggtga |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31806432 |
attatcagtcatctataggtaataggttggaggtga |
31806397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 125
Target Start/End: Complemental strand, 8724317 - 8724264
Alignment:
| Q |
72 |
agttagttacagttaaataagcaagttcaaagttagttataactggttacttgt |
125 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
8724317 |
agttagttacaccaaaataagctagttcaaagttagttataattggttacttgt |
8724264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University