View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3215-Insertion-8 (Length: 222)

Name: NF3215-Insertion-8
Description: NF3215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3215-Insertion-8
NF3215-Insertion-8
[»] chr2 (1 HSPs)
chr2 (28-63)||(31806397-31806432)
[»] chr8 (1 HSPs)
chr8 (72-125)||(8724264-8724317)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 63
Target Start/End: Complemental strand, 31806432 - 31806397
Alignment:
28 attatcagtcatctataggtaataggttggaggtga 63  Q
    ||||||||||||||||||||||||||||||||||||    
31806432 attatcagtcatctataggtaataggttggaggtga 31806397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 125
Target Start/End: Complemental strand, 8724317 - 8724264
Alignment:
72 agttagttacagttaaataagcaagttcaaagttagttataactggttacttgt 125  Q
    |||||||||||   |||||||| ||||||||||||||||||| |||||||||||    
8724317 agttagttacaccaaaataagctagttcaaagttagttataattggttacttgt 8724264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University