View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3215-Insertion-9 (Length: 264)
Name: NF3215-Insertion-9
Description: NF3215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3215-Insertion-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 48596678 - 48596508
Alignment:
| Q |
8 |
ctctgatcttgttggtgcccttgcaccacggatccctgcaaatgttgatcaccagttgcggtggttgttgatggtggcgtaattggcgaggaggtgagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596678 |
ctctgatcttgttggtgcccttgcaccacggatccctgcaaatgttgatcaccagttgcggtggttgttgatggtggcgtaattggcgaggaggtgagat |
48596579 |
T |
|
| Q |
108 |
aatagaggggattcatgttgttgttattattaacaagcaggtgatcagcagcaggagcagggtggtggtac |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596578 |
aatagaggggattcatgttgttattattatcaacaagcaggtgatcagcagcaggagcagggtggtggtac |
48596508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 48596477 - 48596425
Alignment:
| Q |
212 |
gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgaga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596477 |
gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgaga |
48596425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University