View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3215-Insertion-9 (Length: 264)

Name: NF3215-Insertion-9
Description: NF3215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3215-Insertion-9
NF3215-Insertion-9
[»] chr7 (2 HSPs)
chr7 (8-178)||(48596508-48596678)
chr7 (212-264)||(48596425-48596477)


Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 48596678 - 48596508
Alignment:
8 ctctgatcttgttggtgcccttgcaccacggatccctgcaaatgttgatcaccagttgcggtggttgttgatggtggcgtaattggcgaggaggtgagat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48596678 ctctgatcttgttggtgcccttgcaccacggatccctgcaaatgttgatcaccagttgcggtggttgttgatggtggcgtaattggcgaggaggtgagat 48596579  T
108 aatagaggggattcatgttgttgttattattaacaagcaggtgatcagcagcaggagcagggtggtggtac 178  Q
    |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
48596578 aatagaggggattcatgttgttattattatcaacaagcaggtgatcagcagcaggagcagggtggtggtac 48596508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 48596477 - 48596425
Alignment:
212 gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgaga 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
48596477 gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgaga 48596425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University