View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3215R-Insertion-7 (Length: 315)
Name: NF3215R-Insertion-7
Description: NF3215R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3215R-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 51011263 - 51011043
Alignment:
| Q |
8 |
atattatatttacctcaactttaaaaacatttgagacaagacccttatgactggttactgtggcatgcattacatccatgcctaaagtgttgaaagcatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011263 |
atattatatttacctcaactttaaaaacatttgagacaagacccttatgactggttactgtggcatgcattacatccatgcctaaagtgttgaaagcatc |
51011164 |
T |
|
| Q |
108 |
catcaatttcacaaaaccaccaggcctatgctcacaaaacaccttcacaaagtactcattcccatctatctgagccacttccacttgtgtctgcaatatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51011163 |
catcaatttcacaaaaccaccaggcctatgctcacaaaacaccttcacaaagtactcattaccatctatctgagccacttccacttgtgcctgcaatatt |
51011064 |
T |
|
| Q |
208 |
cattcatctgttactacacttttta |
232 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
51011063 |
catg----tgttactacacttttta |
51011043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 263 - 298
Target Start/End: Complemental strand, 51011001 - 51010966
Alignment:
| Q |
263 |
gttacctccatctgctgtgtctgcttgtcagtaaca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011001 |
gttacctccatctgctgtgtctgcttgtcagtaaca |
51010966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University