View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3217_low_4 (Length: 209)

Name: NF3217_low_4
Description: NF3217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3217_low_4
NF3217_low_4
[»] chr1 (1 HSPs)
chr1 (1-198)||(32103465-32103662)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 32103662 - 32103465
Alignment:
1 gaaaaaactgtttggtaatgactgaatgaataaagaatggcggctccatctccattaggcagtaagcttcaaaacatgttgcaggctgcggtgcaatctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32103662 gaaaaaactgtttggtaatgactgaatgaataaagaatggctgctccatctccattaggcagtaagcttcaaaacatgttgcaggctgcggtgcaatctg 32103563  T
101 ttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttttcctcttcctcactcactatatattcttcttct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32103562 ttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttttcctcttcctcactcactatatattcttcttct 32103465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University