View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_high_17 (Length: 321)
Name: NF3218_high_17
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 4111415 - 4111370
Alignment:
| Q |
162 |
agatctatagatctctaacatttttacaaccaaagacagaaaaggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4111415 |
agatctatagatctctaacatttttacaaccaaagacagaaaaggt |
4111370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 269 - 305
Target Start/End: Complemental strand, 4111308 - 4111272
Alignment:
| Q |
269 |
ttaataaagttttcttacttaatctgttcattgattg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4111308 |
ttaataaagttttcttacttaatctgttcattgattg |
4111272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University