View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_high_20 (Length: 284)
Name: NF3218_high_20
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 80 - 268
Target Start/End: Original strand, 16194593 - 16194780
Alignment:
| Q |
80 |
attcttgcatgtagattgtttttaagggattctaatccaaggagatattcttcttctgatattgttatactgaagtgattacctttcacaatcggtttgg |
179 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16194593 |
attctggcatgtagattgttttaaagg-attctaatccaaggagatattcttcttctgatattgttatactgaagtgattacctttcacaatcggtttgg |
16194691 |
T |
|
| Q |
180 |
gagttggatggtggggatgtcacatacattagcaagggcatgggcataagtttgattcagggagcttcactgaggcttggccaggggat |
268 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16194692 |
gagttggatggtggggatgtcacagacattagcaagggcatgggcataagtttgattcagggagcttcactgaggcatggccaggggat |
16194780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University