View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_high_41 (Length: 226)
Name: NF3218_high_41
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 14538306 - 14538512
Alignment:
| Q |
19 |
atgaattgccgagttctttcattttatattttggagaatgtttaactactctttagatatttgcaaaaatgggatcttctccctttatggcgagcacagc |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14538306 |
atgaatcgccgagttctttcattttatattttggagaatgtttaactactctttagatatttgcaaaaatgggatcttctccctttatggcgagcacagc |
14538405 |
T |
|
| Q |
119 |
tgttgtgtcagtcagtcta------------------gcctttatgtaggagaggaatacagaccaaggtggctgtttgattgattttgtgcagaaatag |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14538406 |
tgttgtgtcagtcagtctagagaaaatctgactgtctgcctttatgtaggagaggaatacagaccaaggtggctgtttgattgattttgtgcagaaatag |
14538505 |
T |
|
| Q |
201 |
catttcc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
14538506 |
catttcc |
14538512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University