View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_low_26 (Length: 254)
Name: NF3218_low_26
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 30545068 - 30545306
Alignment:
| Q |
15 |
cagagagaatggtttatttaaggtatctatcaaattacaagtgttcaacatgttgataagatcgtattagtagaatgctgcctattgttannnnnnnata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30545068 |
cagagagaatggtttatttaaggtatctatcaaattacaagtgttcaacatgttgataagatcgtattagtagaatgctgcctattgttatttttttata |
30545167 |
T |
 |
| Q |
115 |
cttgttttggagtgttgaatcatgagaaaatgttatgttgcttaagactttgaaagacctttctcttgaaggaaataagacacatgagcttggatccttg |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30545168 |
cttgttttggagtgttgaatcttgagaaaatgttatgttgcttaagactttgaaagacctttctcttgaaggaaataagacacatgagcttggatccttg |
30545267 |
T |
 |
| Q |
215 |
tggaaatggatcctctcaattttgtctgtctcatgtttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30545268 |
tggaaatggatcctctcaattttgtctgtctcatgtttt |
30545306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University