View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_low_31 (Length: 246)
Name: NF3218_low_31
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 43 - 228
Target Start/End: Complemental strand, 29796327 - 29796145
Alignment:
| Q |
43 |
ggtatttaagactaactggatattttacacaatcccaattatctcttttgttattgcttttcaaagtattttagttcaatcttattgttcctaagcaaca |
142 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29796327 |
ggtattaaagactaactggatattttacacaatcccaat---ctcttttgttattgcttttcaaagtattttagttcaatcttattgttcctaagcaaca |
29796231 |
T |
|
| Q |
143 |
tcattaagcatgcattacagaactgtaactattcgatcttagataatgaacaatggattgagatttgaagtttgataacggcaaat |
228 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29796230 |
ccattaagcatgcattatagaactgtaactattcgatcttagatattgaacaatggattgagatttgaagtttgataacggcaaat |
29796145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 62 - 192
Target Start/End: Complemental strand, 26623648 - 26623516
Alignment:
| Q |
62 |
atattttacacaatcc-caattatctctttt-gttattgcttttcaaagtattttagttcaatcttattgttcctaagcaacatcattaagcatgcatta |
159 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| | ||||||||||||||| ||||| |||| |||||||| |||||| ||||| |||||||| |
|
|
| T |
26623648 |
atattttacacaatcgacaattatctctttttgttatggggtttcaaagtattttaattcaaccttactgttcctacgcaacacttttaagtatgcatta |
26623549 |
T |
|
| Q |
160 |
cagaactgtaactattcgatcttagataatgaa |
192 |
Q |
| |
|
|||| ||||| ||||| ||||| |||| |||| |
|
|
| T |
26623548 |
tagaattgtaattattcaatctttgatattgaa |
26623516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University