View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3218_low_42 (Length: 216)
Name: NF3218_low_42
Description: NF3218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3218_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 16193766 - 16193963
Alignment:
| Q |
1 |
tcttcattcaattgtgtagcatcaacaaattcaaatgtttcggagttgttctcttggtcatgattttgcatttggtaccttgttagtgacatattctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16193766 |
tcttcattcaattgtgtagcatcaacaaattcgaatgtttgggagttgttctcttggtcatgattttgcatttggtaccttgttagtgacatattctatg |
16193865 |
T |
|
| Q |
101 |
ttttcatctattagattatctgcaagtcctatcttcacttcatagtcctgtactgcatttgttttgcctgcttccttatcacttatgttatgtacttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
16193866 |
ttttcatctattagattatctgcaagtcctatcttgacttgatagtcctgtaatgcatttgttttgcctgcttccttatcacttatgtaatgtgcttc |
16193963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University