View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_21 (Length: 351)
Name: NF3219_high_21
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 7 - 217
Target Start/End: Complemental strand, 34580727 - 34580517
Alignment:
| Q |
7 |
aacccgcgtacgagaacgaaacaaaattgcagaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactctacc |
106 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34580727 |
aacccacgtacgagaacaaaacaaaattgcaaaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactcgacc |
34580628 |
T |
 |
| Q |
107 |
gctaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34580627 |
actaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata |
34580528 |
T |
 |
| Q |
207 |
acttaatgcag |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
34580527 |
acttaatgcag |
34580517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 329
Target Start/End: Complemental strand, 34580446 - 34580404
Alignment:
| Q |
287 |
gtaatttagccaaatttatacaaccattatactacgttattga |
329 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34580446 |
gtaatttagcaaaatttatacaaccattatactacgttattga |
34580404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University