View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3219_high_28 (Length: 323)

Name: NF3219_high_28
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3219_high_28
NF3219_high_28
[»] chr2 (2 HSPs)
chr2 (1-111)||(29061354-29061464)
chr2 (209-315)||(29061145-29061251)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 29061464 - 29061354
Alignment:
1 tgcttctcaagcaacttgaagagaaaattatttattacatattaggattttggtgattcaaacacaatatatataactatttagtataactggtttatag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
29061464 tgcttctcaagcaacttgaagagaaaattatttattacatattacgattttggtgattcaaacataatatatataactatttagtataactggtttatag 29061365  T
101 agccctagaaa 111  Q
    |||||||||||    
29061364 agccctagaaa 29061354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 209 - 315
Target Start/End: Complemental strand, 29061251 - 29061145
Alignment:
209 attgtttcacctttaataataacgataatgattgttacggtcgtaatatgaattataaatcaaatatgttagttatgtttaattttgattttgtgtttac 308  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
29061251 attgtttcacctttaataataacaataatgattgttacagtcgtaatatgaattataaatcaaatatgttagttatgtttaattttggttttgtgtttac 29061152  T
309 ctttgct 315  Q
    |||||||    
29061151 ctttgct 29061145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University