View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_29 (Length: 316)
Name: NF3219_high_29
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 128 - 306
Target Start/End: Original strand, 12504115 - 12504284
Alignment:
| Q |
128 |
agctattagtgaatttgttcgcttttaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaattgtctttagttcgaccccacagctaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12504115 |
agctattagtgaatttgttcgctttcaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaatt---------tcgaccccacagctaa |
12504205 |
T |
 |
| Q |
228 |
tctataagtgaaattataaaaacgtgagacaattttaggctgaatctgtgcacgatcaaatttaatgcgctgaaatatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
12504206 |
tctataagtgaaattataaaaacgtgagacaattttaggctgaatctgtacacgaccaaatttagtgcgctgaaatatt |
12504284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University