View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_39 (Length: 260)
Name: NF3219_high_39
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 410315 - 410133
Alignment:
| Q |
18 |
aacagcacgtgctctatcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410315 |
aacagcacgtgctctatcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttcca |
410216 |
T |
|
| Q |
118 |
aatcccattattgctaatgttttcccaaccatagatactcccacatacttgcttcttagccattttcctgcaaaaattatcaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
410215 |
aaccccattattgctaatgttttcccaaccatagatactccaacatacttgcttctcagccattttcctgcaaaaattatcaa |
410133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 173
Target Start/End: Complemental strand, 48785548 - 48785408
Alignment:
| Q |
33 |
atcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgct |
132 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| || ||||| || | || || |||||||| ||||| |||| |||||| || ||||||||||||| || |
|
|
| T |
48785548 |
atcagcaggagcataaggatcatgagcaataaccttcataccaagccccttagcacgcctagcaacctcagttccaaccttcccaaatcccattacagca |
48785449 |
T |
|
| Q |
133 |
aatgttttcccaaccatagatactcccacatacttgcttct |
173 |
Q |
| |
|
| ||| |||||||| | || ||||| |||||||| ||||| |
|
|
| T |
48785448 |
agtgtcttcccaactagggaaactccaacatacttacttct |
48785408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University