View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_44 (Length: 249)
Name: NF3219_high_44
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33009741 - 33009974
Alignment:
| Q |
1 |
aaccgatccgagaagaaaaagtccaaggagaaatcctctccccaatttttggtaacatttcagagactgattgcttatttcatcactactttgattctga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33009741 |
aaccgatccgagaagaaaaattccaaggagaaatcctctccccaatttttggtaacatttcagagactgattgcttatttcatcactactttgattctga |
33009840 |
T |
 |
| Q |
101 |
tttgaattccttgatttttgtttatatttggatatgcagggtaaatggaagagcatgttgaaacagctatcatgcaaagaaatatagtatagcagtgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33009841 |
tttgaattccttgatttttgtttatatttggatatgcagggtaaatggaagagcatgttgaaacagctatcatgcaaagaaa-----tatagcagtgaag |
33009935 |
T |
 |
| Q |
201 |
aagaacatttttgtatttcaataccatttgatatttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33009936 |
aagaacatttttgtatttcaataccatttgatatttcat |
33009974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University