View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_48 (Length: 242)
Name: NF3219_high_48
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 51 - 231
Target Start/End: Original strand, 21099217 - 21099393
Alignment:
| Q |
51 |
ggatgatgatattgaaatacaagaggagattgagggacttaatggtcaagagctatatgtaaaagcagacgttttcattaggaacttctacaaacagttg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21099217 |
ggatgatgatattgaaatacaagaggagattgagggacttaatggtcaagagctatatgtaaaagcagacgttttcattaggaacttctacaaacagttg |
21099316 |
T |
 |
| Q |
151 |
aagctgcagaaagatgaatcttagatttattagaaagttttataattaataatgtgatttctatagtcttaaagtagaaac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21099317 |
aagctgcagaaagatgaatcttagatttattagaaagtttta----taataatgtgatttctatagtcttaaagtagaaac |
21099393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University