View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_high_60 (Length: 223)
Name: NF3219_high_60
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 52 - 213
Target Start/End: Original strand, 40466294 - 40466455
Alignment:
| Q |
52 |
aacctttgatatgtgtggttgatggtgtataagcacggttatatggtatatataaaggcaaaaataagcataaagtttgaactcgtatttaccacatcat |
151 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466294 |
aacctttgatatgagtggttgatggtgtataagcacggttatatggtatatataaaggcaaaaataagcataaagtttgaactcgtatttaccacatcat |
40466393 |
T |
 |
| Q |
152 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466394 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtg |
40466455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University