View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_15 (Length: 392)
Name: NF3219_low_15
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Original strand, 33096553 - 33096938
Alignment:
| Q |
1 |
aagtgaacaggtcatagaatggttttcatcaccattctttacaagtaaatatgcttttatatgaagtactatggttgctaaactttttatatgatt---c |
97 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33096553 |
aagttaacaggtcagagaattgttttcatcaccattctttacaagtaaatatgcttttatatgaagtactatggttgctaaactttttatatgattattc |
33096652 |
T |
|
| Q |
98 |
tagtaattttagaatactttcatcactagcaatgctatttggtagaaatattgacatcgagatctttattagtagtgttaagggaatggaaatattactg |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33096653 |
tagtcattttagaatactttcatcactagcaatgctatttggtagaaatattgacatcgagatctttattagtagtgttaagggaatggaaatattactg |
33096752 |
T |
|
| Q |
198 |
gctgcattttaattataacatgcctttgtgtatctcatattgttttaaactttatggcatacatgccaacaattctagtagatacacacataacacgttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33096753 |
gctgcattttaattataacatgcctttgtgtatctcatattgttttaaactttat-gcatacatgccaacaattctagtagatacacacataacacattt |
33096851 |
T |
|
| Q |
298 |
aaaattttatcacctcttgaattgtatcacttattaaagaaatcaatttaattttatgccaaggtttcattgttttttcttcttctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33096852 |
aaaattttatcacctcttgaattgtatcacttattaaagaaatcaatgtaattttatgccaaggtttcattgttttttcttcttctc |
33096938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 40743164 - 40743220
Alignment:
| Q |
148 |
ttgacatcgagatctttattagtagtgttaagggaatggaaatattactggctgcat |
204 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
40743164 |
ttgacatggagatctttattagttgtgtcaagggaatggaaatattactggctgcat |
40743220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University