View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3219_low_16 (Length: 388)

Name: NF3219_low_16
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3219_low_16
NF3219_low_16
[»] chr2 (1 HSPs)
chr2 (1-370)||(6578165-6578534)
[»] chr7 (1 HSPs)
chr7 (305-370)||(42202011-42202076)
[»] chr1 (1 HSPs)
chr1 (305-355)||(31305830-31305880)
[»] chr8 (1 HSPs)
chr8 (305-342)||(42641467-42641504)


Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Complemental strand, 6578534 - 6578165
Alignment:
1 tgcagctttgaatttgatacaagctgcgcaaatagttagtataatgataatcaccacataccaccaaacactgatggaactgagttgtaaaggagcatca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||    
6578534 tgcagctttgaatttgatacaagctgcgcaaatagttagtataatgataatcaccacataccaccaaacactgatggaactgagttatgaaggatcatca 6578435  T
101 tcagaagaaaaccaccaatcttccggggaagctttttgtggcgctgcgacgaaagaagcagtcgatgattcgggaggagaacttctgggggccacagaag 200  Q
    ||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
6578434 tcagaagaaaaccaccaatcttccggggaagcgggttgtggcgctgcgacgaaagaagcagtcgatgattcgggaggagaacttctggtggccacagaag 6578335  T
201 acaccaagacagaaggtgacattggaattagtgccttccttggtgactgtgatttggtatgagatgaagcagctagagattgatctcaacaacaaggcag 300  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6578334 acaccaagacagaaggtgacataggaattagtgccttccttggtgactgtgatttggtatgagatgaagcagctagagattgatctcaacaacaaggcag 6578235  T
301 ccacgagggatgctaaggacaatctctcttgcactctctcttagacactctttcattcattggtccacat 370  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
6578234 ccacgagggatgctaaggacaatctctcttgcactctctcttagacactttttcattcattggtccacat 6578165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 305 - 370
Target Start/End: Original strand, 42202011 - 42202076
Alignment:
305 gagggatgctaaggacaatctctcttgcactctctcttagacactctttcattcattggtccacat 370  Q
    |||||||||||| || ||| | |||| |||| ||||||||||||||||| ||||||||||||||||    
42202011 gagggatgctaacgataatatatcttacactttctcttagacactcttttattcattggtccacat 42202076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 355
Target Start/End: Complemental strand, 31305880 - 31305830
Alignment:
305 gagggatgctaaggacaatctctcttgcactctctcttagacactctttca 355  Q
    |||| ||||||||||||| |||||| ||||||||||||| |||||||||||    
31305880 gaggaatgctaaggacaacctctctcgcactctctcttaaacactctttca 31305830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 342
Target Start/End: Complemental strand, 42641504 - 42641467
Alignment:
305 gagggatgctaaggacaatctctcttgcactctctctt 342  Q
    |||||||||||||||||||| ||||| |||||||||||    
42641504 gagggatgctaaggacaatcactcttacactctctctt 42641467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University