View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_16 (Length: 388)
Name: NF3219_low_16
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Complemental strand, 6578534 - 6578165
Alignment:
| Q |
1 |
tgcagctttgaatttgatacaagctgcgcaaatagttagtataatgataatcaccacataccaccaaacactgatggaactgagttgtaaaggagcatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
6578534 |
tgcagctttgaatttgatacaagctgcgcaaatagttagtataatgataatcaccacataccaccaaacactgatggaactgagttatgaaggatcatca |
6578435 |
T |
 |
| Q |
101 |
tcagaagaaaaccaccaatcttccggggaagctttttgtggcgctgcgacgaaagaagcagtcgatgattcgggaggagaacttctgggggccacagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6578434 |
tcagaagaaaaccaccaatcttccggggaagcgggttgtggcgctgcgacgaaagaagcagtcgatgattcgggaggagaacttctggtggccacagaag |
6578335 |
T |
 |
| Q |
201 |
acaccaagacagaaggtgacattggaattagtgccttccttggtgactgtgatttggtatgagatgaagcagctagagattgatctcaacaacaaggcag |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6578334 |
acaccaagacagaaggtgacataggaattagtgccttccttggtgactgtgatttggtatgagatgaagcagctagagattgatctcaacaacaaggcag |
6578235 |
T |
 |
| Q |
301 |
ccacgagggatgctaaggacaatctctcttgcactctctcttagacactctttcattcattggtccacat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6578234 |
ccacgagggatgctaaggacaatctctcttgcactctctcttagacactttttcattcattggtccacat |
6578165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 305 - 370
Target Start/End: Original strand, 42202011 - 42202076
Alignment:
| Q |
305 |
gagggatgctaaggacaatctctcttgcactctctcttagacactctttcattcattggtccacat |
370 |
Q |
| |
|
|||||||||||| || ||| | |||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
42202011 |
gagggatgctaacgataatatatcttacactttctcttagacactcttttattcattggtccacat |
42202076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 355
Target Start/End: Complemental strand, 31305880 - 31305830
Alignment:
| Q |
305 |
gagggatgctaaggacaatctctcttgcactctctcttagacactctttca |
355 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
31305880 |
gaggaatgctaaggacaacctctctcgcactctctcttaaacactctttca |
31305830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 342
Target Start/End: Complemental strand, 42641504 - 42641467
Alignment:
| Q |
305 |
gagggatgctaaggacaatctctcttgcactctctctt |
342 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
42641504 |
gagggatgctaaggacaatcactcttacactctctctt |
42641467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University