View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3219_low_21 (Length: 351)

Name: NF3219_low_21
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3219_low_21
NF3219_low_21
[»] chr6 (2 HSPs)
chr6 (7-217)||(34580517-34580727)
chr6 (287-329)||(34580404-34580446)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 7 - 217
Target Start/End: Complemental strand, 34580727 - 34580517
Alignment:
7 aacccgcgtacgagaacgaaacaaaattgcagaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactctacc 106  Q
    ||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
34580727 aacccacgtacgagaacaaaacaaaattgcaaaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactcgacc 34580628  T
107 gctaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata 206  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34580627 actaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata 34580528  T
207 acttaatgcag 217  Q
    |||||||||||    
34580527 acttaatgcag 34580517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 329
Target Start/End: Complemental strand, 34580446 - 34580404
Alignment:
287 gtaatttagccaaatttatacaaccattatactacgttattga 329  Q
    |||||||||| ||||||||||||||||||||||||||||||||    
34580446 gtaatttagcaaaatttatacaaccattatactacgttattga 34580404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University