View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_28 (Length: 323)
Name: NF3219_low_28
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 29061464 - 29061354
Alignment:
| Q |
1 |
tgcttctcaagcaacttgaagagaaaattatttattacatattaggattttggtgattcaaacacaatatatataactatttagtataactggtttatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061464 |
tgcttctcaagcaacttgaagagaaaattatttattacatattacgattttggtgattcaaacataatatatataactatttagtataactggtttatag |
29061365 |
T |
 |
| Q |
101 |
agccctagaaa |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
29061364 |
agccctagaaa |
29061354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 209 - 315
Target Start/End: Complemental strand, 29061251 - 29061145
Alignment:
| Q |
209 |
attgtttcacctttaataataacgataatgattgttacggtcgtaatatgaattataaatcaaatatgttagttatgtttaattttgattttgtgtttac |
308 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29061251 |
attgtttcacctttaataataacaataatgattgttacagtcgtaatatgaattataaatcaaatatgttagttatgtttaattttggttttgtgtttac |
29061152 |
T |
 |
| Q |
309 |
ctttgct |
315 |
Q |
| |
|
||||||| |
|
|
| T |
29061151 |
ctttgct |
29061145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University