View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_30 (Length: 312)
Name: NF3219_low_30
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 7 - 298
Target Start/End: Original strand, 1792401 - 1792693
Alignment:
| Q |
7 |
aaattgacctgaaataaaacacnnnnnnnggttgcataatttatgcaaaaactcacaattcccataaggcatgaaactttgcaaaaaaggcatggaagct |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792401 |
aaattgacctgaaataaaacacaaaaaaaggttgcataatttatgcaaaaactcacaattcccataaggcatgaaactttgcaaaaaaggcatggaagct |
1792500 |
T |
|
| Q |
107 |
tatacaaatttgcataacacttaagtacgaaaatgataaagatatcattgaatcacac-nnnnnnngtcttttattcttgggactttcttaatcgttgtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1792501 |
tatacaaatttgcataacacttaagtacgaaaatgataaagatatcattgaatcacacttttttttgtcttttattcttgggactttcttaatcgttgtc |
1792600 |
T |
|
| Q |
206 |
aaatttagaggaaaacatgggtaaacgtggcaatgacaaaacccttggctcaaagaatgtgcaaaacacaaataactccttgtgcttcacccc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792601 |
aaatttagaggaaaacatgggtaaacgtggcaatgacaaaacccttggttcaaagaatgtgcaaaacacaaataactccttgtgcttcacccc |
1792693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University