View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_31 (Length: 311)
Name: NF3219_low_31
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 6 - 273
Target Start/End: Complemental strand, 13114745 - 13114479
Alignment:
| Q |
6 |
agcagcagagaggggtgacgcaaaaccaaattaattaccactgggatggatatccctggctggtataaatatacatacaccaagaacaaacacaggtttt |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114745 |
agcaacagagaggggtgacgcaaaaccaaattaattaccactgggatggatatccctggctggtataaatatacatacaccaagaacaaacacaggtttt |
13114646 |
T |
 |
| Q |
106 |
tattgtcaacttgtaatttgaaaagctcttaaaatacagatacaccatatttatctatctactttaagaaaagttttcttataataacatgtgatacatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114645 |
tattgtcaacttgtaatttgaaaagctcttaaaatacagatacaccatatttatctatctactttaagaaaagttttcttataataacatgtgatacatt |
13114546 |
T |
 |
| Q |
206 |
ttcgcatgtctttttctaccttgtgctgccctagattcgtgcaaagagcacgatatttttactatagc |
273 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114545 |
ttcgcatgtctttttctaccttgt-ctgccctagattcgtgcaaagagcacgatatttttactatagc |
13114479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University