View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_34 (Length: 279)
Name: NF3219_low_34
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 15 - 274
Target Start/End: Complemental strand, 2013900 - 2013643
Alignment:
| Q |
15 |
ataaccaacacctctgatcatttatttttcttcaaattattatcagtgtataagtatcagtgtcgtgtcaggtgtctgtgtaggtttttcataggtgtat |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2013900 |
ataaccaacacctctgatcattttttttt--tcaaattattatctgtgtataagtatcagtgtcgtgtctcgtgtctgtgtaggtttttcataggtgtat |
2013803 |
T |
|
| Q |
115 |
gtttggaggaattagacatggaaatgaaaattagaagaacagagtaaaaaatgaatcatcagaaacaacaagaacaccaacttgcgttgcgttcaacaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2013802 |
gtttggaggaattagacatggaaatgaaaattagaagaacaaagtaaaaaatgaatcatcagaaacaacaagaacaccaacctgcgttgcgttcaacaga |
2013703 |
T |
|
| Q |
215 |
aatgataatgggaagcgcgggaaggaaacgagatgcaaacaactctggatttcatctcac |
274 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013702 |
aatgatagtgggaagcgcgggaaggaaacgagatgcaaacaactctggatttcatctcac |
2013643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University