View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_35 (Length: 277)
Name: NF3219_low_35
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 73 - 263
Target Start/End: Complemental strand, 17578118 - 17577928
Alignment:
| Q |
73 |
cttctgcttctgatttcgccgaattcactgatttcaacgtgtgtttttatttgcattcagagaattggtgatgtttcgaaggagattaagagagtgagag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17578118 |
cttctgcttctgatttcgccgaattcactgatttcaacgtgtgtttttatttgcattcagagaattggtgatgtttcgaaggagattaagagagtgagag |
17578019 |
T |
|
| Q |
173 |
cgcaaatggaagaagatgaacaattggcaacgcttatgagaggtcttcgtggtcagagtcttaatgattcgctctttgctgaggatgatgt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17578018 |
cgcaaatggaagaagatgaacaattggcaacgcttatgagaggtcttcgtggtcagagtcttaatgattcgctctttgctgaggatgatgt |
17577928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 46
Target Start/End: Complemental strand, 17578173 - 17578144
Alignment:
| Q |
17 |
caaacctgtcaacggtgtctctggggtaaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17578173 |
caaacctgtcaacggtgtctctggggtaaa |
17578144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University