View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_45 (Length: 248)
Name: NF3219_low_45
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 23043883 - 23043666
Alignment:
| Q |
15 |
tatgcatagtaatgaaaggattaacatatattttgtttgtttatgagaaagtggttcatcataactggtagacccataaacaactacaatcacatgacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23043883 |
tatgcatagtaatgaaaggattaacatatatttcatttgttcatgagaaagtggttcatcataactggtaggcccataaacaactacaatcacatgacaa |
23043784 |
T |
 |
| Q |
115 |
acataaacaacaaataatagatgctttagattgtgcatcaagagttagccatggcttgtactctgattgacaacaaaatagtcattgttggttagacaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23043783 |
acataaacaacaaataatagatgctttagattgtgcatcaagagttagccatggcttgtactctgattaacaacaaaatagtcattgttggttagacaca |
23043684 |
T |
 |
| Q |
215 |
aaataggttaagcattct |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23043683 |
aaataggttaagcattct |
23043666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University