View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_46 (Length: 247)
Name: NF3219_low_46
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 231
Target Start/End: Original strand, 29061582 - 29061808
Alignment:
| Q |
5 |
tttcaaaagattggtggtaaacatgaaacaagatataaacttacccttgatcataggattgtcagacatgattgtaggtgctcctaatctcttatatatg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061582 |
tttcaaaagattggtggtaaacatgaaacaagatataaacttatccttgatcataggattgtcagacatgattgtaggtgctcctaatctcttatatatg |
29061681 |
T |
|
| Q |
105 |
catagtgagtttctaggattcctcatgcaagctttcataggcgannnnnnnnnattgaattgtaatatcctacaatgtaatcgttataatatttgaaggg |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061682 |
catagtgactttctaggattcctcatgcaagctttcataggcgggttttttttattgaattgtaatatcctacaatgtaatcgttataatatttgaaggg |
29061781 |
T |
|
| Q |
205 |
aaaagatgagttgagtggggagagagt |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29061782 |
aaaagatgagttgagtggggagagagt |
29061808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University