View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_47 (Length: 247)
Name: NF3219_low_47
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 17577151 - 17577388
Alignment:
| Q |
11 |
gaaacagaaagcaagggagaatnnnnnnnccaccgacaatgaccaccatgtcaagaatgcacgcaagctgcttagtct-atctggacatagaaaaattac |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17577151 |
gaaacagaaagcaagggagaataaaaaaaccaccgacaataaccaccatgtcaggaatgcacgcaagctgcttagtcttatctggacatagaaaaattac |
17577250 |
T |
 |
| Q |
110 |
ctctttaaccttcttgttaaccacatcccacgcaacccgcgaaagaaaacctccagcaacagataataactgcacaatgcgagttgcaacggagcgagga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17577251 |
ctctttaaccttcttgttaaccacatcccacgcaacccgcgaaagaaaacctccagcaacagataataactgcacaatgcgagttgcaacggagcgagga |
17577350 |
T |
 |
| Q |
210 |
cgttttccccaatatgcagtaatactagctggatcata |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17577351 |
cgttttccccaatatgcagtaatactagctggatcata |
17577388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University