View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_65 (Length: 216)
Name: NF3219_low_65
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_65 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 49540992 - 49541203
Alignment:
| Q |
1 |
tatatattctaaagatattttagaaatcaacataataacaacgtgacaattttgttgtggattaatcggataatgtgtataaaaaattatagtagtagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||| || |
|
|
| T |
49540992 |
tatatattctaaagatattttagaaatcagcataataacaaagtgacaattttgttgtggattaatgggataatgtgtataaaaaatta---tagtacat |
49541088 |
T |
 |
| Q |
101 |
gtaaattaatttaagtacagagtcggcaaaagacaaaataaattgatcgataattattggtcaatggtaaactgcacctggtcaaaggtgacatgaatga |
200 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49541089 |
gtaaattaatttaagtaaagggtgggcaaaagacaaaataaattgatcgat-attattggtcaatggtgaactgcacctggtcaaaggtgacatgaatga |
49541187 |
T |
 |
| Q |
201 |
atatactgggcaccta |
216 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
49541188 |
atattctgggcaccta |
49541203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University