View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3219_low_67 (Length: 206)

Name: NF3219_low_67
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3219_low_67
NF3219_low_67
[»] chr2 (1 HSPs)
chr2 (1-188)||(27477468-27477645)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 27477468 - 27477645
Alignment:
1 ttgagatgattatgttaaatgatcttatggtctaacatgcagagattataaaaaaggatattatggtgtgacttgcgtatgttgtgaaataatactatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27477468 ttgagatgattatgttaaatgatcttatggtctaacatgcagagattataaaaaaggatattatggtgtgacttgcgtatgttgtgaaataatactatgg 27477567  T
101 tgtaacatgcagaaattgtaaatgggatgtagtggagaaaccacaaaattttgttagaaggatactatagagaaagtcggaggtttat 188  Q
    ||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27477568 tgtaacatgcagaaattgta----------agtggagaaaccacaaaattttgttagaaggatactatagagaaagtcggaggtttat 27477645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University