View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_68 (Length: 205)
Name: NF3219_low_68
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 45293258 - 45293089
Alignment:
| Q |
13 |
caaaggtagaaatgttaggacctcaaactaaggtttctgctagcagaattatggaatggagtaggactgtggggattggggaaggaagatatatgagaga |
112 |
Q |
| |
|
|||||||||||||||||| |||||||| | |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45293258 |
caaaggtagaaatgttagaacctcaaattgaggtttttgctagcagaattatggaatggagtaggactgtgggga-------aggaagatatatgagaga |
45293166 |
T |
 |
| Q |
113 |
atattttctggaacacacttggaacaacggtagagacagctttcaatgtaattgaagggtcctggtagggaaaaaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45293165 |
atattttctggaacacacttggaacaacggtagagacagctttcaatgtaattgaagggtcctggtagggaaaaaat |
45293089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 44780696 - 44780837
Alignment:
| Q |
12 |
gcaaaggtagaaatgttaggacctcaaactaaggtttctgctagcagaattatggaatggagtaggactgtggggattggggaaggaagatatatgagag |
111 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||| |||||| ||||||| || |||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
44780696 |
gcaaaggtagaatcgttagg-cctcaaactgaggtttgtgctagaagaattaagggatggagtatgcctgtggg-------gaaggaagatatatgagag |
44780787 |
T |
 |
| Q |
112 |
aatattttctggaacacacttggaacaacggtagagacagctttcaatgt |
161 |
Q |
| |
|
|||||||||||| | || |||||||||||| |||||||||||||||| |
|
|
| T |
44780788 |
aatattttctggcgcgtgctgggaacaacggtatagacagctttcaatgt |
44780837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 89 - 161
Target Start/End: Original strand, 28329278 - 28329350
Alignment:
| Q |
89 |
tggggaaggaagatatatgagagaatattttctggaacacacttggaacaacggtagagacagctttcaatgt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | || |||||||||||| |||||||||||||||| |
|
|
| T |
28329278 |
tggggaaggaagatatatgagagaatattttctggcgcgtgctgggaacaacggtatagacagctttcaatgt |
28329350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University