View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3219_low_9 (Length: 456)
Name: NF3219_low_9
Description: NF3219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3219_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 346
Target Start/End: Complemental strand, 49400983 - 49400642
Alignment:
| Q |
7 |
gagagaagaagaggttctatcagagtatataaacgagacgagggtatgacgtgtgatgtgggaaactctaattatgtatgattcgtttggctaagagaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49400983 |
gagagaagaagaggttctatcagagtatataaacgagacgagggtatgacgtgtgatgtgggaaactctaattatgtatgattcgtttggctaagagaga |
49400884 |
T |
 |
| Q |
107 |
ggatactaatcaatcaattaggtgttttacaaaacttaaactacttttcatagaaagaagct-aatactttagatttttatccaaaaataaaagaaactt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||| ||| || |
|
|
| T |
49400883 |
ggatactaatcaatcaattaggtgttttacaaaacttaaactacttttcatagaaagaagctcaatactacggatttttatcgaaaaataaaacaaattt |
49400784 |
T |
 |
| Q |
206 |
ttcttaaattatttatcg-ttgacgaactttatgaaccacttgagtttaattgtttgattttttgatacacatcgattgattggacattaaaataaggag |
304 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
49400783 |
ttcttaaattatttgtcgtttaacgaactttatgaaccacttgagtttaattgtttcattttttgatacacaccgattgattgcacattaaattaaggag |
49400684 |
T |
 |
| Q |
305 |
aatatgtttggtcaaatctctttagatcgtgtatgggtgagg |
346 |
Q |
| |
|
||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
49400683 |
aatatgtaaggtcaaatctctttagatcgtgtacggatgagg |
49400642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 456
Target Start/End: Complemental strand, 49400614 - 49400534
Alignment:
| Q |
376 |
ttagacaataggcgagttcgggctcaaaatatcaatctagcctgatcaacggttgccaattgtcatatggtggcttatctc |
456 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| ||| ||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
49400614 |
ttagacaatgggcgagttcgggctcaaaacatcaatctagcatgaacaacggttgccaattatcatatgatggcctatctc |
49400534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University