View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3220_low_13 (Length: 238)
Name: NF3220_low_13
Description: NF3220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3220_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 3015660 - 3015880
Alignment:
| Q |
18 |
tgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttacaattggtttgcatgtttgttatcgcatcgagtttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015660 |
tgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttgcaattggtttgcatgtttgttatcgcatcgagtttat |
3015759 |
T |
|
| Q |
118 |
caaaatcacggtgagctaccataattttgtaaaagtcacaggttgtggcttttgaaaatcatgttgtctcaccgcgattaatggggtgagtcttgccaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015760 |
caaaatcacggtgagctaccataattttgtaaaagtcacatgttgtggcttttgaaaatcatgttgtctcaccgcgattaatggggtgagtcttgccaaa |
3015859 |
T |
|
| Q |
218 |
aattgattatggagggtgcct |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3015860 |
aattgattatggagggtgcct |
3015880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University