View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3220_low_9 (Length: 307)
Name: NF3220_low_9
Description: NF3220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3220_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 289
Target Start/End: Complemental strand, 44409922 - 44409654
Alignment:
| Q |
17 |
atgaaggtagcattttgatttgcagcatatatactacttaggtatggttgttgggataacgaacactaagcaattttacatcatcaataacaggtccaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44409922 |
atgaaggtagcattttgatttgcagcata----ctacttaggtatggttgttgggataacgaacactaagcaattttacatcatcaataacaggtccaca |
44409827 |
T |
|
| Q |
117 |
aagagaaccagagttatcattcttcatggtgtaaaatgtacttaggaacctaatcctagtacgtcttgtcgatgccttaaaacgaagtttgcctctaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44409826 |
aagagaaccagagttatcattcttcatggtgtaaaatgtacttaggaacctaatcctagtacgtcttgtcgatgccttaaaacgaagtttgcctctaaca |
44409727 |
T |
|
| Q |
217 |
aaccctcctttacccttagattgatatggaacttgaacagtgtctctaccagcaaatgcttctacggtcatag |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44409726 |
aaccctcctttacccttagattgatatggaacttgaacagtgtctctaccagcaaatgcttctacggtcatag |
44409654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 82 - 123
Target Start/End: Complemental strand, 2287543 - 2287502
Alignment:
| Q |
82 |
ctaagcaattttacatcatcaataacaggtccacaaagagaa |
123 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
2287543 |
ctaagcaacttgacatcatcaataacaggaccacaaagagaa |
2287502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University